-
PurposeTemplate for T7 RNAP production of RNA transcript for expression of firefly luciferase in a eukaryotic mammalian cell free lysate.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePromega L482A
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2678
- Total vector size (bp) 4331
-
Modifications to backboneSequence modified from T7 promoter to ATG of the luciferase AGACCCAAGCTTTCAGATCCGCTAGCGCTACCGGGGATCCagccacc
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
-
Alt nameFFluc
-
SpeciesPhotinus pyralis
-
Insert Size (bp)1653
- Promoter T7 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AATACGCAAACCGCCTCTC
- 3′ sequencing primer GGTGATGTCGGCGATATAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPromega
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is only for the production of transcript not for expression in mammalian cells.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7-CMVtrans-FFLuc-polyA was a gift from Marcel Bruchez (Addgene plasmid # 101156 ; http://n2t.net/addgene:101156 ; RRID:Addgene_101156) -
For your References section:
In Vitro Reversible Translation Control Using gammaPNA Probes. Canady TD, Telmer CA, Oyaghire SN, Armitage BA, Bruchez MP. J Am Chem Soc. 2015 Aug 19;137(32):10268-75. doi: 10.1021/jacs.5b05351. Epub 2015 Aug 4. 10.1021/jacs.5b05351 PubMed 26241615