pTETRIS-cargo
(Plasmid
#126033)
-
Purpose(Empty Backbone) Luciferase reporter construct for the study of cis-repressive activity in long noncoding RNAs. Also confers puromycin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepiggyBac cargo vector
-
Backbone manufacturerSystem Biosciences
-
Vector typeMammalian Expression, Luciferase ; piggyBac
- Promoter TRE
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGATAGAGAACGTATGTCGAGGTAG
- 3′ sequencing primer GTCAGTGAGCGAGGAAGCTCGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLuciferase was cloned from pGl4.10-Luciferase (Promega). TRE promoter was cloned from pTRE-Tight (Clontech).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTETRIS-cargo was a gift from Mauro Calabrese (Addgene plasmid # 126033 ; http://n2t.net/addgene:126033 ; RRID:Addgene_126033) -
For your References section:
Functional classification of long non-coding RNAs by k-mer content. Kirk JM, Kim SO, Inoue K, Smola MJ, Lee DM, Schertzer MD, Wooten JS, Baker AR, Sprague D, Collins DW, Horning CR, Wang S, Chen Q, Weeks KM, Mucha PJ, Calabrese JM. Nat Genet. 2018 Oct;50(10):1474-1482. doi: 10.1038/s41588-018-0207-8. Epub 2018 Sep 17. 10.1038/s41588-018-0207-8 [pii] PubMed 30224646