-
PurposeRecoded E. coli strain without TCG, TCA, or TAG codons in all open reading frames. Full sequence - GenBank: CP040347.1
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 174513 | Bacteria in agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneNA
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)This is a recoded E.coli strain
-
Growth instructionsStreptomycin resistant by virtue of K43R mutation in rpsL. Grow in LB or 2xYT, 100 micrograms/mL streptomycin to maintain
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRecoded E. coli strain without TCG, TCA, or TAG codons
-
GenBank IDCP040347.1
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames.
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Syn61 was a gift from Jason W Chin (Addgene plasmid # 174513) -
For your References section:
Total synthesis of Escherichia coli with a recoded genome. Fredens J, Wang K, de la Torre D, Funke LFH, Robertson WE, Christova Y, Chia T, Schmied WH, Dunkelmann DL, Beranek V, Uttamapinant C, Llamazares AG, Elliott TS, Chin JW. Nature. 2019 May;569(7757):514-518. doi: 10.1038/s41586-019-1192-5. Epub 2019 May 15. 10.1038/s41586-019-1192-5 PubMed 31092918