-
PurposeThis plasmid encodes the mouse Mars gene with the L274G mutation under a CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1+
- Total vector size (bp) 8086
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMarsL274G
-
Alt nameMars
-
Alt namemethionine-tRNA synthetase (L274G)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2753
-
MutationL274G
-
GenBank IDNP_001003913
-
Entrez GeneMars1 (a.k.a. Mars, Metrs, Mtrns)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (not destroyed)
- 3′ cloning site xho1 (not destroyed)
- 5′ sequencing primer GCTCTCTGGCTAACTAGAGAACCCACTGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Developed by Alborz Mahdavi.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMarsL274G was a gift from David Tirrell (Addgene plasmid # 63177 ; http://n2t.net/addgene:63177 ; RRID:Addgene_63177) -
For your References section:
Engineered Aminoacyl-tRNA Synthetase for Cell-Selective Analysis of Mammalian Protein Synthesis. Mahdavi A, Hamblin GD, Jindal GA, Bagert JD, Dong C, Sweredoski MJ, Hess S, Schuman EM, Tirrell DA. J Am Chem Soc. 2016 Apr 6;138(13):4278-81. doi: 10.1021/jacs.5b08980. Epub 2016 Mar 25. 10.1021/jacs.5b08980 PubMed 26991063