-
PurposeExpresses Mj aaRS for sulfotyrosine and Mj tRNA for decoding UAG codons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUltra
- Backbone size w/o insert (bp) 4056
- Total vector size (bp) 4977
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPick medium/small colonies from LB Agar plates. The SS320 and C321.ΔA (Addgene catalog ID: 48998) strains were used in the associated publication.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMethanococcus jannaschii aaRS for sulfotyrosine
-
Alt nameSTyrRS
-
Speciesmethanococcus jannaschii
-
Insert Size (bp)921
-
MutationTyr32Leu, Leu65Pro, Asp158Gly, Ile159Cys, Leu162Lys
- Promoter tacI
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TCGTATAATGTGTGGAATTG
- 3′ sequencing primer TGATGACTCTCCAGAAGAGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPeter Schultz
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUltra-sY was a gift from Chang Liu (Addgene plasmid # 82417 ; http://n2t.net/addgene:82417 ; RRID:Addgene_82417) -
For your References section:
A second-generation expression system for tyrosine-sulfated proteins and its application in crop protection. Schwessinger B, Li X, Ellinghaus TL, Chan LJ, Wei T, Joe A, Thomas N, Pruitt R, Adams PD, Chern MS, Petzold CJ, Liu CC, Ronald PC. Integr Biol (Camb). 2016 Apr 18;8(4):542-5. doi: 10.1039/c5ib00232j. Epub 2015 Nov 27. 10.1039/c5ib00232j PubMed 26611838