1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 14945: pLDLR-Luc mutSRE
  • LDLR promoter mut SRE

  • LDL receptor promoter

  • LDL receptor

  • 340

  • H. sapiens (human)

  • NC_000019

  • LDLR (FH, FHC, LDLCQ2)

  • luciferase

  • C terminal on backbone

  • Point mutation in the SRE-1 sequence of the LDL receptor promoter (ATCACCCCAC changed to ATAACCCCAC)

  • pGL2 basic
    (Search Vector Database)

  • Promega

  • Mammalian Expression, Luciferase

  • 5597

  • SacI

  • No

  • XhoI

  • No

  • n/a List of Sequencing Primers

  • LucNrev

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • Axel Nohturfft

  • MTA
    Luciferase Limited Use Label License

Comments: 

Primers used for site-directed mutagenesis: 5'- ggtgaagacatttgaaaataaccccactgcaaactcc -3' and 5'-GGAGTTTGCAGTGGGGTTATTTTCAAATGTCTTCACC -3'

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Transcriptional regulation of phagocytosis-induced membrane biogenesis by sterol regulatory element binding proteins. Castoreno et al (Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13129-34. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 14945" in your Materials and Methods section.