Please acknowledge the principal investigator and cite this article if you use
this plasmid in a publication. Also, please include the text "Addgene plasmid
14945" in your Materials and Methods section.
Home
| Contact
| Terms of Use
| Privacy Policy
| Site Map
| MTA and Licenses
| One Kendall Sq B7102 Cambridge MA 02139
| 617.225.9000
Addgene is a non-profit plasmid repository.
We archive and distribute high quality plasmids from your colleagues.
Primers used for site-directed mutagenesis: 5'- ggtgaagacatttgaaaataaccccactgcaaactcc -3' and 5'-GGAGTTTGCAGTGGGGTTATTTTCAAATGTCTTCACC -3'