pAAV-flex-rev-g2-2A-Venus
(Plasmid
#71410)
-
PurposeThis plasmid is pAAV-panpromoter-flex-rev-gamma2F77-2A-Venus. Confers zolpidem sensitivity on zolpidem-insensitive neurons.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 7748
-
Vector typeMammalian Expression, AAV, Cre/Lox
- Promoter mouse hdc gene promoter, works as a pan neuronal promoter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ACGCTGAACTTGTGGCCGTTTA
- 3′ sequencing primer TTTTGCTTGTTCAATCTTGTTTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was constructed from two others: pAAV-CAG-promoter-Cre-2A-gamma22F77, kindly provided by Zoltan Nusser, Institute of Experimental Medicine, Hungarian Academy of Sciences, Budapest, Hungary (Sumegi M., et al., 2012, J Physiol 590: 1517); and pAAV-flex-rev-hM4-mCherry (Addgene plasmid 44362, gift of Bryan Roth, University of North Carolina at Chapel Hill, USA; (Krashes MJ et al., 2011, J Clin Invest 121: 1424). The promoter fragment from the mouse hdc gene is unpublished, but we found it works as a panneuronal promoter, although it was intended to be selective for histaminergic neurons.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid allows the introduction of zolpidem sensitivity into non-zolpidem senstive neurons. It has to be used in conjuction with the mouse line gabrg2I77lox (deposited in JAX labs, stock number, https://www.jax.org/strain/021197 (Gabrg2tm1Wul).
This plasmid was constructed from two others: pAAV-CAG-promoter-Cre-2A-gamma22F77, kindly provided by Zoltan Nusser, Institute of Experimental Medicine, Hungarian Academy of Sciences, Budapest, Hungary (Sumegi M., et al., 2012, J Physiol 590: 1517); and pAAV-flex-rev-hM4-mCherry (Addgene plasmid 44362, gift of Bryan Roth, University of North Carolina at Chapel Hill, USA; (Krashes MJ et al., 2011, J Clin Invest 121: 1424). The promoter fragment from the mouse hdc gene is unpublished, but we found it works as a panneuronal promoter, although it was intended to be selective for histaminergic neurons.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-flex-rev-g2-2A-Venus was a gift from William Wisden (Addgene plasmid # 71410 ; http://n2t.net/addgene:71410 ; RRID:Addgene_71410) -
For your References section:
Bottom-Up versus Top-Down Induction of Sleep by Zolpidem Acting on Histaminergic and Neocortex Neurons. Uygun DS, Ye Z, Zecharia AY, Harding EC, Yu X, Yustos R, Vyssotski AL, Brickley SG, Franks NP, Wisden W. J Neurosci. 2016 Nov 2;36(44):11171-11184. 10.1523/JNEUROSCI.3714-15.2016 PubMed 27807161