Gg 3kb Green opsin GFP
(Plasmid
#72919)
-
Purposegreen opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913–4,501,931 in galGal4 driving GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
-
Modifications to backboneno basal GFP Hsiau TH, Diaconu C, Myers CA, Lee J, Cepko CL, Corbo JC.2007. The cis-regulatory logic of the mammalian photore-ceptor transcriptional network. PloS One 2:e643.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namechicken green opsin promoter
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)2967
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TGTGACAGGGACACTGAAGG
- 3′ sequencing primer TATTATGGCAGCTGCTTTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Gg 3kb Green opsin GFP was a gift from Joseph Corbo (Addgene plasmid # 72919 ; http://n2t.net/addgene:72919 ; RRID:Addgene_72919) -
For your References section:
Transcriptome profiling of developing photoreceptor subtypes reveals candidate genes involved in avian photoreceptor diversification. Enright JM, Lawrence KA, Hadzic T, Corbo JC. J Comp Neurol. 2015 Mar 1;523(4):649-68. doi: 10.1002/cne.23702. Epub 2014 Dec 1. 10.1002/cne.23702 PubMed 25349106