pHD066
(Plasmid
#84032)
-
PurposeVector for creating transgenic zebrafish. Expresses mCherry-Cre fusion protein under the elastase promoter and Venus under the crystalin promoter in zebrafish
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84032 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneunknown
-
Vector typeCre/Lox ; Zebrafish transgenesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCre
- Promoter Elastase
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameVenus
- Promoter Crystalin
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer SV40pA-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Designed in a pBluescript series vector containing I-SceI meganuclease sites. The I-SceI meganuclease method is a common method for establishing transgenic zebrafish lines.
Please note that the Addgene verified sequence differs from the depositor's reference sequence (see supplemental materials above). The following differences do not alter plasmid functions described in the publication:
- 1kb deletion at the 5' end of the elastase promoter
- 2 other single nucleotide mismatches in elastase promoter
- L88K amino acid residue substitution in the mCherry fluor
- f1 origin is in the opposite orientation
- one mismatch in the ColE1 origin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHD066 was a gift from Daniel Hesselson & Didier Stainier (Addgene plasmid # 84032 ; http://n2t.net/addgene:84032 ; RRID:Addgene_84032) -
For your References section:
Suppression of Ptf1a activity induces acinar-to-endocrine conversion. Hesselson D, Anderson RM, Stainier DY. Curr Biol. 2011 Apr 26;21(8):712-7. doi: 10.1016/j.cub.2011.03.041. Epub 2011 Apr 14. 10.1016/j.cub.2011.03.041 PubMed 21497092