pMega-MaPylRS
(Plasmid
#200225)
-
PurposeThe plasmid encodes an orthogonal aminoacyl-tRNA synthetase/tRNA-CUA pair for amber codon suppression with Nε-Boc-lysine.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUltra
-
Backbone manufacturerPeter Schultz
- Backbone size w/o insert (bp) 4029
- Total vector size (bp) 4928
-
Modifications to backboneAdded a lacO site following the proK promoter to make tRNA expression IPTG-inducible.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePyrrolysyl-tRNA synthetase
-
Alt namePylRS
-
Alt namepyrrolysine-tRNA(Pyl) ligase
-
SpeciesCandidatus Methanomethylophilus alvus
-
Insert Size (bp)827
-
Mutationnone
-
GenBank IDAGI85861.1 WP_015505008
- Promoter tacI
-
Tag
/ Fusion Protein
- none
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGCTGTTGACAATTAATCATCGGCTCG
- 3′ sequencing primer ggcggatgagagaagattttcagcc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepyrrolysyl-tRNA
-
Alt nametRNA-Pyl
-
Alt namePylT
-
SpeciesCandidatus Methanomethylophilus alvus
-
Insert Size (bp)71
-
Mutationnone
-
GenBank IDLR699000.1 CP017686.1
- Promoter proK-lacO
-
Tag
/ Fusion Protein
- none
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTGCTTCTCAAATGCCTGAGGC
- 3′ sequencing primer cctcaggcatttgagaagcacacg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byWe obtained the original pUltra backbone from Prof. Abhishek Chatterjee who originally designed the plasmid while a post-doc with Pete Schultz. We inserted the genes through Gibson assembly with a synthetic DNA fragment (gblock).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMega-MaPylRS was a gift from Alanna Schepartz (Addgene plasmid # 200225 ; http://n2t.net/addgene:200225 ; RRID:Addgene_200225) -
For your References section:
Expanding the substrate scope of pyrrolysyl-transfer RNA synthetase enzymes to include non-alpha-amino acids in vitro and in vivo. Fricke R, Swenson CV, Roe LT, Hamlish NX, Shah B, Zhang Z, Ficaretta E, Ad O, Smaga S, Gee CL, Chatterjee A, Schepartz A. Nat Chem. 2023 Jun 1. doi: 10.1038/s41557-023-01224-y. 10.1038/s41557-023-01224-y PubMed 37264106